(C) PLOS One [1]. This unaltered content originally appeared in journals.plosone.org.
Licensed under Creative Commons Attribution (CC BY) license.
url:https://journals.plos.org/plosone/s/licenses-and-copyright

------------



A pigtailed macaque model of Kyasanur Forest disease virus and Alkhurma hemorrhagic disease virus pathogenesis

['Rebecca M. Broeckel', 'Laboratory Of Virology', 'Rocky Mountain Laboratories', 'National Institute Of Allergy', 'Infectious Diseases', 'National Institutes Of Health', 'Hamilton', 'Montana', 'United States Of America', 'Friederike Feldmann']

Date: 2022-01 

Abstract Kyasanur Forest disease virus (KFDV) and the closely related Alkhurma hemorrhagic disease virus (AHFV) are emerging flaviviruses that cause severe viral hemorrhagic fevers in humans. Increasing geographical expansion and case numbers, particularly of KFDV in southwest India, class these viruses as a public health threat. Viral pathogenesis is not well understood and additional vaccines and antivirals are needed to effectively counter the impact of these viruses. However, current animal models of KFDV pathogenesis do not accurately reproduce viral tissue tropism or clinical outcomes observed in humans. Here, we show that pigtailed macaques (Macaca nemestrina) infected with KFDV or AHFV develop viremia that peaks 2 to 4 days following inoculation. Over the course of infection, animals developed lymphocytopenia, thrombocytopenia, and elevated liver enzymes. Infected animals exhibited hallmark signs of human disease characterized by a flushed appearance, piloerection, dehydration, loss of appetite, weakness, and hemorrhagic signs including epistaxis. Virus was commonly present in the gastrointestinal tract, consistent with human disease caused by KFDV and AHFV where gastrointestinal symptoms (hemorrhage, vomiting, diarrhea) are common. Importantly, RNAseq of whole blood revealed that KFDV downregulated gene expression of key clotting factors that was not observed during AHFV infection, consistent with increased severity of KFDV disease observed in this model. This work characterizes a nonhuman primate model for KFDV and AHFV that closely resembles human disease for further utilization in understanding host immunity and development of antiviral countermeasures.

Author summary Kyasanur Forest disease virus (KFDV) and Alkhurma hemorrhagic disease virus (AHFV) are tick-borne flaviviruses that cause viral hemorrhagic fevers in India and the Arabian Peninsula, respectively. Bonnet macaques and black-faced langurs are susceptible to KFDV infection, but these animals do not experience hemorrhagic signs as seen in human cases with KFDV. This work characterizes for the first time experimental infection of KFDV and AHFV in pigtailed macaques (PTMs). Infected PTMs can develop moderate to severe disease that models multiple features of human disease, including some hemorrhagic signs. Together these data describe the PTM model for KFDV and AHFV as a valuable tool for future work to study viral pathogenesis and for assessing the efficacy of vaccines and antivirals.

Citation: Broeckel RM, Feldmann F, McNally KL, Chiramel AI, Sturdevant GL, Leung JM, et al. (2021) A pigtailed macaque model of Kyasanur Forest disease virus and Alkhurma hemorrhagic disease virus pathogenesis. PLoS Pathog 17(12): e1009678. https://doi.org/10.1371/journal.ppat.1009678 Editor: Sujan Shresta, La Jolla Institute for Allergy and Immunology, UNITED STATES Received: May 26, 2021; Accepted: October 15, 2021; Published: December 2, 2021 This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication. Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. The RNAseq dataset has been deposited in NCBI’s Gene Expression Omnibus with accession number GSE185797 and can be accessed at: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE185797 All other relevant data are within the manuscript and its Supporting Information files. Funding: This study was funded by the Division of Intramural Research, National Institutes of Health, National Institute of Allergy and Infectious Diseases (F.B. and S.M.B). The Vaccine and Infectious Diseases Organization (VIDO) receives operational funding from the Canada Foundation for Innovation - Major Science Initiatives Fund and from the Government of Saskatchewan through Innovation Saskatchewan and the Ministry of Agriculture (A.L.R.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist.

Introduction Tick-borne flaviviruses (TBFVs) can cause encephalitis or hemorrhagic fevers in humans and are considered emerging in parts of Asia, India, Europe and North America. Transmission of these viruses to humans primarily occurs following the bite of infected ticks. Specific viruses of concern include tick-borne encephalitis virus (TBEV), Powassan virus (POWV), Kyasanur Forest disease virus (KFDV), Alkhurma hemorrhagic fever virus (AHFV) and Omsk hemorrhagic fever virus (OHFV). In particular, KFDV and AHFV pathogenesis is not well understood. AHFV and KFDV cause fatal hemorrhagic fevers in humans, are listed as NIAID category C priority pathogens, and require maximum containment facilities to conduct research. KFDV was originally discovered in the Shimoga district of Karnataka state in India, but has expanded its geographical distribution in the last decade to include Kerala, Goa, and Maharashtra states [1]. An estimated 100–900 cases of KFDV occur annually with a 2–10% case-fatality rate [1–3]. KFDV causes a sudden onset of acute febrile illness including headache, fever, vomiting, diarrhea, inflammation of the eyes, and dehydration. Disease may progress to include hemorrhagic signs particularly bleeding from nose, gums, gastrointestinal tract, or lungs [3]. AHFV is a newly emerging genetic variant of KFDV that was first isolated in 1995 [4, 5]. While KFDV is localized to southwest India, AHFV cases have been identified in Egypt and Saudi Arabia [4, 6]. AHFV causes similar febrile illness and hemorrhagic disease in humans as observed with KFDV [7]. However, very little is known regarding mechanisms of disease including how the virulence potential compares between the two virus species. The expanding geographic range of TBFVs witnessed over the last several decades, the steady increase in annual cases, and the potential for severe clinical disease necessitates the development of relevant animal models to study viral pathogenesis and to evaluate vaccines and antiviral therapies [1, 8, 9]. In the case of KFDV and AHFV, small animal models have limitations in that they do not recapitulate key aspects of human disease. Several commonly available strains of laboratory mice are susceptible to KFDV and AHFV infection, with mice developing neurological signs 5–10 days after infection associated with high virus burden in the brain at clinical endpoints [10–14]. However, the neurotropic nature of KFDV and AHFV in the mouse model does not recapitulate the hemorrhagic nature of human disease. Other commonly used small animal models (ferrets, guinea pigs, and hamsters) do not show signs of disease following infection with KFDV, despite the presence of virus in the brain of infected hamsters [15]. Non-human primate (NHP) models have not been described for AHFV, while several NHP species have been inoculated with KFDV, with susceptibility to infection being highly species-dependent. Early reports suggested that rhesus macaques (Macaca mulatta) infected with KFDV may develop viremia but clinical signs of disease were absent [3, 16]. Red-faced bonnet macaques (Macaca radiata) and black-faced langurs (Presbytis entellus) are naturally susceptible to KFDV, and clusters of KFDV human cases coincide with discovery of deceased bonnet macaques and langurs in local forested areas [3]. Experimental infection of these two NHP species demonstrated that black-faced langurs in particular are highly susceptible to KFDV and succumbed to infection during the viremic phase [17]. Bonnet macaques infected with KFDV experience a biphasic illness with 10–100% lethality depending on the study [17–20]. The acute phase is characterized by dehydration, hypotension, bradycardia and diarrhea, while neurological signs such as tremors may be observed in the second phase [17, 18, 20, 21]. However, no hemorrhagic signs were reported in these animals associated with mild decreases in platelets [18, 19]. In addition, infected bonnet macaques develop a second neurological disease phase more frequently that human KFDV disease, with KFDV routinely isolated from macaque brain and CSF [18, 21]. Finally, while bonnet macaques and black-faced langurs have application to studying KFDV disease, these species are not readily available for biomedical research outside of India, thus preventing their wider use as a comparative model for KFDV. The mild nature of KFDV infection in rhesus macaques is likely to be multifaceted. However, rhesus macaques possess a restriction factor called tripartite motif protein 5 (TRIM5) that is well known for its ability to prevent HIV replication through its recognition of the retroviral capsid lattice [22, 23]. Recently, our group showed that TRIM5 is also strongly restrictive to TBFVs, including KFDV, through TRIM5 interaction with the viral protease and RNA helicase NS2B/3 [24]. Unlike rhesus macaques, the TRIM5 gene of pigtailed macaques (PTMs) has undergone a retrotransposition event where cyclophilin A (CypA) replaces the B30.2/PRY/SPRY domain of TRIM5 primarily responsible for interactions with viral substrates [25]. This renders PTM TRIM-Cyp non-restrictive to retroviruses [26], and most likely also prevents recognition of the flavivirus NS2B/3 protein [24]. The lack of TRIM5-mediated restriction in PTMs was important for the development of a NHP model for HIV-1[26]. Hence, our ongoing hypothesis is that the PTM TRIM-Cyp fusion protein is non-restrictive to TBFVs and that this may reduce intrinsic barriers to infection and predispose PTMs to clinical disease following inoculation with KFDV and AHFV. In an effort to develop improved disease models, we investigated whether PTMs were susceptible to infection with KFDV and AHFV. KFDV- and AHFV-infected PTMs displayed moderate to severe clinical illness with hemorrhagic signs. The PTM KFDV and AHFV models closely follow reports of KFDV and AHFV infection in humans and capture aspects of human disease that have not been described in other KFDV NHP models. Transcriptomic analysis in blood of PTMs inoculated with KFDV or AHFV revealed differences in clotting factor downregulation that may contribute to enhanced pathogenesis following inoculation with KFDV compared to AHFV. Thus PTMs represent an important model for countermeasure development against these emerging viruses.

Conclusion The emergence of AHFV in the Arabian Peninsula and the increasing geographical range of KFDV in India highlights the urgent need for relevant animal models for testing vaccines and therapeutics. In this study, PTMs were tested for susceptibility and disease following infection with KFDV or AHFV. We found that animals inoculated by the sc/iv route demonstrated moderate to severe disease with KFDV and AHFV. KFDV infection in humans is commonly characterized by a sudden onset of fever, muscle weakness, back ache, vomiting, diarrhea, headache, reddened eyes, and some hemorrhagic manifestations such as bleeding from gums, or recurring epistaxis [31]. In rare cases, the bleeding can be more severe, with hematemesis and hematochezia, and/or hemorrhage in the lungs. Consistent with case reports in humans, PTMs inoculated with KFDV had clinical signs such as weakness, loss of appetite, flushed appearance, epistaxis, and dehydration. Clinical signs were similar but less severe after infection with AHFV. One major advantage of the PTM model over current models is that these animals experienced marked thrombocytopenia and hemorrhagic manifestations following inoculation with KFDV and to a lesser extent AHFV. In the KFDV group, most animals experienced epistaxis during the acute phase, except one animal that reached the euthanasia criteria at an early time point. Two animals inoculated with KFDV had hyperemic lungs, and one animal inoculated with AHFV had hemorrhages in the lung and liver. Together, the PTM model for KFDV and AHFV closely resembles human infection and can be used for exploration into mechanisms of KFDV and AHFV pathogenesis. Mechanisms underlying KFDV-induced hemorrhage have been postulated to result from either direct infection of endothelial cells or indirect activation of endothelial cells via cytokine release from infected dendritic cells and macrophages [35]. However, RNAseq of whole blood from our study suggests that animals infected with KFDV had an early suppression of clotting factor gene expression which combined with marked thrombocytopenia likely explains hemorrhage. In contrast, DEGs in AHFV-infected PTMs at 2 dpi included upregulation of clotting factors which may explain why KFDV induces more severe disease than AHFV in the PTM model. Infectious virus was frequently isolated from the gastrointestinal tissues, lungs, and lymph nodes in PTMs inoculated with KFDV or AHFV. In-situ hybridization revealed that the infection at these sites was associated with lymphoid tissue, particularly in the GALT, BALT, and the B cell zone within lymph nodes. These results are similar to reports of KFDV-infected bonnet macaques where antigen was seen in lymphocytes in the spleen as well as lymphoid cells in the gastrointestinal tract in KFDV-infected animals [18]. However, bonnet macaques inoculated with KFDV showed virus positivity in epithelial cells within the gastrointestinal tract, but this was not observed in tissues from infected PTMs. Virus infection within lymphoid tissue such as the GALT or the BALT in NHPs has been shown with other viruses known to infect lymphocytes such as measles virus, and HIV [36, 37]. Within lymphoid tissue, virus positivity in B cell follicles has been observed in other viral infection models including Zika virus-infected rhesus macaques, and in SIV-infected rhesus macaques [38, 39]. This phenomenon could be evidence of trapped virus within B cell zones, possibly associated with follicular dendritic cells. While monocytes/macrophages are known targets of flavivirus infections, the consequences of potential B cell infection or antigen positivity is not described. A recent report of human infection with KFDV showed decreased levels of activated B cells in the acute phase of illness [40]. The association of virus and B cells in the PTMs could provide mechanism for this phenomenon. B cell activation was not measured in the current study, but the KFDV-infected PTMs developed neutralizing antibodies associated with the resolution of viremia at 7–9 dpi, suggesting that the B cells were functional in this model. KFDV is considered primarily a viscerotropic disease, where the second disease phase with CNS involvement is rare in humans [3, 31]. Approximately three weeks following the acute phase, a second phase of illness may occur in roughly 10–20% of cases, characterized by recurrence of fever, headache, tremors, and neck stiffness [31, 32, 41]. The current study examined KFDV and AHFV in PTMs up to 9 dpi in the animals inoculated sc/iv when the primary disease was clearly resolving. Future work could extend the observation period to 4–5 weeks post infection to determine the incidence of this secondary phase of disease in PTMs. However, KFDV was found in the brain of only one animal euthanized at 6 dpi, suggesting that virus localization in the brain may be an uncommon event during the acute phase of disease. In contrast with the PTM model, KFDV is commonly isolated from the brain of infected bonnet macaques, even at acute time points [18–20]. Human case reports with AHFV show central nervous system manifestations, including encephalitis, occurring in about 20–25% of patients [7, 42]. AHFV was not detected in the CNS in inoculated PTMs, which may reflect differences between the PTM model and human cases. However, this study characterizes the acute phase of infection in only four AHFV-infected PTMs. Future work may expand the duration of infection to determine if AHFV migration to the CNS could occur at a later time post infection. It should be noted that the animals used in this study were all females, 10–16 years old. Generally these animals were in good health for their age, with no traditional chronic issues such as diabetes or other endocrinopathies. Additional studies will be necessary to determine if sex or age could influence the infection outcome. In this work, we established that PTM TRIM5 does not block infection of KFDV, further providing rationale to characterize the PTM model for KFDV pathogenesis. Compared to previous reports in rhesus macaques, KFDV appears to cause more severe disease in PTMs. While this is consistent with the pattern of TRIM5 restriction, it is unknown whether additional barriers to KFDV and AHFV replication exist in the PTM model. In development of the HIV-1 PTM pathogenesis model, it was necessary to overcome innate immune barriers such as APOBEC3, tetherin, and MX2 [26, 43, 44]. Future investigation will determine what additional innate immune barriers to infection may exist for KFDV and AHFV, as was found with HIV-1. One aspect of KFDV and AHFV biology that was not addressed in this model was the ability of tick saliva to enhance dissemination and disease. Tick saliva contains a mixture of many factors known to modulate innate and adaptive immune responses (reviewed in [45, 46]). Tick saliva enhances TBFV transmission, dissemination, and impacts disease in sensitive animals [47–56]. Tick saliva has not been used in TBFV NHP models, but its use may improve model development as it is clear from our pilot experiment with the sc route that the skin represents a strong barrier to systemic infection that was overcome by iv inoculation in order to develop PTMs as a disease model. While no antiviral drugs are available to treat TBFV infections, several vaccines have been developed against TBFVs. The current vaccine for KFDV is a formalin-inactivated virus preparation that requires multiple boosters and has limited efficacy. Unfortunately, patients who received the KFDV vaccine may still develop viremia and clinical illness after KFDV infection [40, 57, 58]. While the TBEV vaccine elicits cross-neutralizing antibodies that may protect against KFDV and AHFV [59], the TBEV vaccine is not approved for prevention of disease caused by these hemorrhagic TBFVs. The PTM model of KFDV and AHFV pathogenesis will be useful for future efforts in vaccine and antiviral development, as well as further examining mechanisms of virus pathogenesis.

Methods Ethics statement All work with infectious TBEV, KFDV, and AHFV was conducted at Biosafety Level 4 facilities at the Integrated Research Facility at the Rocky Mountain Laboratories (Hamilton, MT). All experiments involving PTMs were performed in strict accordance with the approved Rocky Mountain Laboratories Animal Care and Use Committee protocol 2018-066-E and following recommendations from the Guide for the Care and Use of Laboratory Animals of the Office of Animal Welfare, National Institutes of Health and the Animal Welfare Act of the US Department of Agriculture, in an Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC)-accredited facility. Pigtailed macaques Twelve female PTMs aged 10 to 16 years of age were housed in a humidity, temperature, and light controlled facility in adjacent cages for social interaction. Animals were closely monitored at least twice daily by trained personnel. Animals were fed a commercial monkey chow twice per day, and their diets were supplemented with a variety of fruits, vegetables, and treats. Water was available ad libitum. Animals were provided with manipulanda, human interaction, and audio and visual enrichment. Virus inoculations were performed with the indicated virus diluted in sterile PBS. For subcutaneous (sc) infections, 1x105 pfu was delivered in a single injection between the shoulder blades (1 ml volume). Intravenous (iv) inoculations were performed with 1x105 pfu diluted virus using an IV catheter (1 ml volume). Animals were closely monitored and scored twice daily after showing signs of illness. Clinical scoring was evaluated by trained veterinary staff in each category: general appearance; skin and haircoat; nose, mouth, eyes, and head; respiration; feces and urine; appetite; and activity level. To calculate the clinical score, scores from each category were totaled on the approved clinical score sheet. Animals were euthanized if they reached a score of 35 or more, which is considered critical illness based on pre-established endpoints. Exams occurred on 0, 2, 4, 6, 8, 10, 14, 21, 28, 35, and 42 or 43 dpi. At each exam, blood was drawn in EDTA and serum separation tubes, and rectal and oral swabs were collected. Hematology analysis was completed on a ProCyte DX (IDEXX Laboratories, Westbrook, ME, USA) and the following parameters were evaluated: red blood cells (RBC), hemoglobin (Hb), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), red cell distribution weight (RDW), platelets, mean platelet volume (MPV), white blood cells (WBC), neutrophil count (abs and %), lymphocyte count (abs and %), monocyte count (abs and %), eosinophil count (abs and %), and basophil count (abs and %). Serum chemistries were completed on a VetScan VS2 Chemistry Analyzer (Abaxis, Union City, CA) and the following parameters were evaluated: glucose, blood urea nitrogen (BUN), creatinine, calcium, albumin, total protein, alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total bilirubin, globulin, sodium, potassium, chloride, and total carbon dioxide. Cells and viruses Vero E6 cells (ATCC CCL-81) and HEK293 cells (ATCC CRL-1573) were grown in Dulbecco’s modified Eagle media (DMEM) containing 10% fetal bovine serum (FBS) and 1% antibiotics Penicillin-Streptomycin in an incubator at 37°C and 5% CO 2 . KFDV (P9605) and AHFV (200300001) seed stocks were obtained from the University of Texas Medical Branch (UTMB) [11]. Virus seed stocks were propagated once on Vero cells, and virus working stocks were aliquoted and frozen in liquid nitrogen tanks. Sequencing confirmed that the AHFV virus stock had no significant snps detected relative to the published sequence JF416954.1. The KFDV virus stock has 8 snps relative to the published sequence JF416958.1: position 6690 A to G, 10551 G to A, 10563 G to A, 10579 T to C, 10580 T to C, 10599 G to A, 10676 C to T, and 10735 A to G. These SNPs resulted in one AA change in NS4A (T2187A), and the other snps were localized to the 3’UTR. Virus isolation Whole blood was collected in Vacutainer EDTA Tubes and overlayed on lymphocyte separation medium (Corning). After centrifugation, the plasma layer was collected and titrated on Vero cells by limiting dilution plaque assays. For virus isolation from tissues, samples were weighed and homogenized in DMEM containing 10% FBS and 1% antibiotics using 5 mm stainless steel beads (Qiagen) and the TissueLyser II (Qiagen). For plaque assays, samples were serially diluted in DMEM and added to Vero cells for 30 minutes to 1 hr while rocking the plate every 15 minutes. The cells were overlaid with 1.5% carboxymethylcellulose (CMC) (Sigma) overlay in Minimum Essential Media (MEM). Following plaque development, plates were flooded with 10% formalin and plaques were visualized with a 1% crystal violet solution. Cytokine and chemokine analysis Sera was inactivated by irradiation with 10 megarads (1 x 105 Gray) according to standard biosafety protocols [60]. Cytokines and chemokines were measured from irradiated sera using a magnetic Cytokine 29-Plex Monkey Panel (ThermoFisher) according to the manufacturer’s instructions. Sera was incubated with antibody beads for 2 hours followed by addition of detection and indicator antibodies. Cytokine levels were detected using a Bio-Plex 200 System with high-throughput fluidics (Bio-Rad). Neutralization assays Neutralization tests were performed on Vero cells by a focus forming reduction assay. Irradiated sera (10 megarads) were heat-inactivated for 1 hr at 56°C. Two-fold serial dilutions of sera (1/20 to 1/40760) were prepared and mixed 1:1 with media containing 50 to 100 ffu of KFDV or AHFV for a final serum dilution of 1/40 to 1/81520. Virus and antibody complexes were incubated at 37°C for two hours. The complexes were then plated onto Vero cells in black 96-well plates for 30 minutes followed by addition of CMC overlay. At 24 hpi, Vero plates were washed once with PBS and flooded with 10% formalin overnight. Plates were removed in fresh 10% formalin according to established sample removal protocols. Plates were permeabilized with 0.1% Triton-X-100 in PBS followed by an incubation in block buffer (1% Bovine serum albumin (BSA) in PBS). Foci were probed with anti-E (11H12), diluted in 0.1% BSA followed by an Alexa Flour 488-conjugated secondary antibody (Invitrogen, A32723). Foci were counted using an Immunospot S6 Universal Analyzer. FRNT50 values were calculated using nonlinear regression analysis. KFDV RNA detection RNA was extracted from 140 μl plasma using the QIAamp Viral RNA Mini Kit (Qiagen). RNA was irradiated (10 megarad) for removal from the BSL4 according to established sample removal protocols [60]. Following removal, cDNA was generated using SuperScript VILO cDNA Synthesis Kit (ThermoFisher). Viral transcripts were detected by qRT-PCR using the Platinum Quantitative PCR SuperMix-UDG with ROX (ThermoFisher). Primer and probe sets used for qRT-PCR assays are as follows: KFDV forward primer: TGGCCAGCAGAGGGTTTTTA, reverse primer: AACGGCCCTCATGATGATCT, probe: CAAAGCGCAGGAGC. H&E Tissues were fixed in 10% Neutral Buffered Formalin x2 changes, for a minimum of 7 days according to IBC approved protocols. Tissues were placed in cassettes and processed with a Sakura VIP-6 Tissue Tek, on a 12-hour automated schedule, using a graded series of ethanol, xylene, and PureAffin. Embedded tissues are sectioned at 5 μm and dried overnight at 42°C prior to staining. In Situ Hybridization (ISH) and microscopy Chromogenic detection of KFDV viral RNA was performed on formalin fixed tissue using the RNAscope VS Universal AP assay (Advanced Cell Diagnostics Inc.) on the Ventana Discovery ULTRA stainer using an RNAscope 2.5 VS Probe—V-KFDV-PP consisting of 20 probe pairs targeting the positive sense RNA at nt 7597–8486 of KFDV (Advanced Cell Diagnostics Inc. cat# 591199). ISH was performed according to manufacturer’s instructions. Fluorescent detection of KFDV ISH and IHC was performed using the RNAscope VS Universal ISH-IHC HRP fluorescent assay (Advanced Cell Diagnostics Inc.) on the Ventana Discovery ULTRA stainer according to manufacturer’s instructions. For the IHC, primary antibodies include CD3 (clone 2GV6) rabbit monoclonal (Roche Tissue Diagnostics cat#790–4341), CD20 rabbit polyclonal (Thermo Fisher Scientific cat#RB-9013), CD68 (clone KP1) mouse monoclonal (Agilent cat#M081401-2), CD21 (Novus Biological cat#NBP2-67605), and CD35 (Novus Biological cat#NBP2-29460). Secondary antibodies include Discovery Red 610 (Roche Tissue Diagnostics cat#760–245), Discovery FITC (Roche Tissue Diagnostics cat#760–232), Discovery OmniMap anti-Rabbit HRP (Roche Tissue Diagnostics cat# 760–4311), and Discovery OmniMap anti-mouse HRP (Roche Tissue Diagnostics cat# 760–4310). Slides were mounted using ProLong Diamond Antifade mountant w/ DAPI (Invitrogen cat# P36971). To obtain the low magnification views of the mesenteric lymph node, samples were imaged using a 10x/0.45 objective on a Zeiss digital slide scanning microscope (Axio Scan.Z1) equipped with a Colibri 7 LED illumination source and driven by ZEN Blue v. 3.1 (Carl Zeiss Microscopy). The samples were then imaged using either a 20x/0.8 or 63x/1.4 objective on a Zeiss laser scanning confocal microscope (LSM 880), driven by ZEN Black v. 2.3 (Carl Zeiss Microscopy). For the datasets acquired with the 63X/1.4 objective, image stacks were exported from ZEN software and deconvolved with Huygens Professional v. 20.10 (Scientific Volume Imaging) using the CMLE algorithm, with SNR = 20 and a maximum of 40 iterations. Generation of TRIM5 stable cell lines PTM TRIMCyp was amplified from Macaca nemestrina cDNA derived from PBMCs. The pigtailed macaque TRIMCyp sequence was most similar to DQ308405 with the following amino acid changes: K44E, E209K, T269A, H373R, S438G. TRIMCyp was then cloned into pWPI DEST lentivirus vectors with an C-terminal HA tag. Rhesus TRIM5 with a C-terminal Flag tag, or an mCherry control gene, was cloned into pLenti6 by restriction enzyme cloning. Stable cell lines were generated by transfecting 5e6 293T cells with 1 μg pMD.G, 8 μg pSPAX2, and 8 μg pWPI vector using the ProFection Mammalian Transfection System (Promega). Supernatant was passed through a 0.45 micron filter and added to HEK293 cells. TRIM5 positive cells were selected with blasticidin S HCl at 10 μg/ml. Following construction of the stable TRIM5 cells, expression was validated by western blotting with an HA antibody (Cell Signaling Technology, mAb #2367) or a flag antibody (Cell Signaling Technology, mAb #14793). NGS library preparation RNA was extracted from EDTA blood using TRIzol LS Reagent (ThermoFisher) according to the manufacturer’s protocol. Resulting RNA (140 μl) was extracted a second time using the QIAamp Viral RNA Mini kit (Qiagen). RNA was irradiated (10 megarad) for removal from the BSL4 according to established sample removal protocols [60]. RNA quality was analyzed using Agilent 2100 Bioanalyzer (Agilent Technologies), and 100 ng of RNA was treated with Qiagen FastSelect -H/M/R and -Globin kits to inhibit cDNA synthesis of rRNA and globin transcripts. cDNA synthesis and sequencing libraries were prepared following the Illumina Stranded RNA Prep, Ligation kit, with an additional 8 amplification cycles using the Kapa HiFi Hot Start amplification kit and assessed for library quality on BioAnalyzer High Sensitivity chips. The samples were quantified using the Kapa SYBR FAST Universal qPCR kit for Illumina sequencing (Kapa Biosystems, Boston, MA) on the CFX384 Real-Time PCR Detection System (Bio-Rad Laboratories, Inc, Hercules, CA). The libraries were normalized to 4 nM, pooled, denatured and further diluted to a 1.5 pM stock for clustering and paired-end 2 x 74 cycle sequencing on the Illumina NextSeq with one Mid Output and 2 High Output chemistry kits. Raw reads were trimmed of adapter sequence using cutadapt (https://cutadapt.readthedocs.io/en/stable/). The remaining reads were then filtered for low quality bases and reads using the FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Remaining reads were mapped to the NC_041754.1 Macaca mulatta genome, using HISAT2, and where sample appropriate, mapped to JF416958.1 Kyasanur forest disease virus strain P9605 or JF416954.1 Alkhumra hemorrhagic fever virus strain 200300001 using Bowtie2. Reads mapping to genes were counted using htseq-count [61]. Differential expression analysis was performed using the Bioconductor package DESeq2 [62]. Functional analysis of transcriptomic data Differential expression data was uploaded to Ingenuity Pathway Analysis (IPA; QIAGEN). IPA Core Analysis was run on differentially expressed genes were those defined as having a fold change > |1.5| relative to the 0 controls and P < 0.05. Enriched pathway lists were filtered by the Benjamini-Hochberg-corrected P value calculated by Fisher’s exact test (< 0.05) and the z-score (> |2|). Enriched pathways were also filtered based on annotation in the IPA knowledgebase. Within-pathway activation was predicted using the IPA Molecular Activity Prediction tool. Statistics Statistics were performed as indicated with a two-way ANOVA followed by Sidaks multiple comparison test or Dunnett’s multiple comparison test. Multiplicity-adjusted P values are reported, and statistical significance are indicated by *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.0001. Error bars represent the standard deviation. All statistical analysis were performed using Graphpad Prism.

Supporting information S1 Fig. Pigtail TRIMCyp does not restrict KFDV replication. A. PTM TRIMCyp-HA and rhesus macaque TRIM5-flag expression in HEK293 cells. B. HEK293 cells were infected with KFDV (MOI = 0.01), and supernatants were collected at T = 0, 24, and 48 hpi and titered on vero cells by limiting dilution plaque assays. Error bars indicate SD across replicate measurements. Statistics were performed on log-transformed data using Tukey’s multiple comparison test (N = 6; *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.0001). https://doi.org/10.1371/journal.ppat.1009678.s001 (TIF) S2 Fig. Pigtailed macaques infected with KFDV by the sc route. A. Two pigtailed macaques were infected with 105 pfu KFDV (sc). Clinical exams occurred on D0, 2, 4, 6, 8, 10, 14, 21, 28, 35, and 43 post infection. Animals were euthanized at day 43 post infection. B. Clinical scores for KFDV-infected animals. C. Quantitative real-time PCR detection of KFDV transcripts derived from plasma on D0 through D8 post infection. D-E. Dilutions of heat-inactivated sera were tested for neutralization of KFDV by plaque assay. Data were normalized to the D0 values, and error bars represent the SD across duplicate measurements. https://doi.org/10.1371/journal.ppat.1009678.s002 (TIF) S3 Fig. KFDV positivity in the lung and brain. Tissues from KFDV sc/iv infected animals were examined for immunoreactivity with a KFDV RNAscope probe for viral RNA. Immunoreactivity was identified in A. bronchus-associated lymphoid tissue (100X, bar = 20 μm), B. choroid plexus (100X, bar = 20 μm), C. bronchus-associated lymphoid tissue (200X, bar = 50 μm), and D. choroid plexus (200X, bar = 50 μm). https://doi.org/10.1371/journal.ppat.1009678.s003 (TIF) S4 Fig. Mesenteric lymph node double staining with AHFV and CD3, CD20, CD21, CD35, or CD68. Mesenteric lymph node sections from an animal infected sc/iv with AHFV was subjected to RNAscope and IHC for CD3, CD20, CD68, CD21, and CD35 using the RNAscope VS Universal ISH-IHC HRP fluorescent assay. AHFV (red) and cell markers (green). Scale bar for low-magnification CD3/AHFV panel, 500 μm; for high-magnification images of CD3, CD20, CD68, CD21, and CD35, 20 μm. https://doi.org/10.1371/journal.ppat.1009678.s004 (TIF) S5 Fig. Mediastinal lymph node double staining with KFDV and DC68. Mediastinal lymph node sections from an animal infected sc/iv with KFDV was subjected to RNAscope and IHC for CD68. KFDV (red) and CD68 (green). https://doi.org/10.1371/journal.ppat.1009678.s005 (TIF) S1 Table. Clinical observations of KFDV-infected pigtailed macaques by the subcutaneous route. https://doi.org/10.1371/journal.ppat.1009678.s006 (DOCX)

Acknowledgments We would like to acknowledge the Rocky Mountain Veterinary Branch animal caretakers for their assistance in these studies. We also acknowledge Heinz Feldmann for sharing of resources and critical review of the manuscript.

[END]

[1] Url: https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1009678

(C) Plos One. "Accelerating the publication of peer-reviewed science."
Licensed under Creative Commons Attribution (CC BY 4.0)
URL: https://creativecommons.org/licenses/by/4.0/


via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/