(C) PLOS One [1]. This unaltered content originally appeared in journals.plosone.org.
Licensed under Creative Commons Attribution (CC BY) license.
url:https://journals.plos.org/plosone/s/licenses-and-copyright

------------



EBV+ tumors exploit tumor cell-intrinsic and -extrinsic mechanisms to produce regulatory T cell-recruiting chemokines CCL17 and CCL22

['Aparna Jorapur', 'Discovery Biology', 'Rapt Therapeutics', 'Inc.', 'South San Francisco', 'California', 'United States Of America', 'Lisa A. Marshall', 'Quantitative Biology', 'Scott Jacobson']

Date: 2022-02 

Abstract The Epstein-Barr Virus (EBV) is involved in the etiology of multiple hematologic and epithelial human cancers. EBV+ tumors employ multiple immune escape mechanisms, including the recruitment of immunosuppressive regulatory T cells (T reg ). Here, we show some EBV+ tumor cells express high levels of the chemokines CCL17 and CCL22 both in vitro and in vivo and that this expression mirrors the expression levels of expression of the EBV LMP1 gene in vitro. Patient samples from lymphoblastic (Hodgkin lymphoma) and epithelial (nasopharyngeal carcinoma; NPC) EBV+ tumors revealed CCL17 and CCL22 expression of both tumor cell-intrinsic and -extrinsic origin, depending on tumor type. NPCs grown as mouse xenografts likewise showed both mechanisms of chemokine production. Single cell RNA-sequencing revealed in vivo tumor cell-intrinsic CCL17 and CCL22 expression combined with expression from infiltrating classical resident and migratory dendritic cells in a CT26 colon cancer mouse tumor engineered to express LMP1. These data suggest that EBV-driven tumors employ dual mechanisms for CCL17 and CCL22 production. Importantly, both in vitro and in vivo T reg migration was effectively blocked by a novel, small molecule antagonist of CCR4, CCR4-351. Antagonism of the CCR4 receptor may thus be an effective means of activating the immune response against a wide spectrum of EBV+ tumors.

Author summary The Epstein-Barr Virus (EBV) is associated with many cancers worldwide, including both lymphomas and solid tumors. EBV+ tumors have been reported to have increased numbers of infiltrating regulatory T cells (T reg ), a cell type that counteracts the body’s natural antitumor response. Here we show that EBV+ tumors actually have amongst the highest levels of T reg of all human tumors, as well as having very high levels of the chemokines CCL17 and CCL22, signaling molecules that promote the migration of T reg . We found that CCL17 and CCL22 production in different EBV+ tumor cell lines mirrored the levels of production of the EBV protein LMP1, and that the LMP1 gene on its own was sufficient to trigger chemokine expression and T reg migration into a mouse tumor model. Depending on the particular EBV+ tumor type, this CCL17 and CCL22 expression could be coming from the tumor cells themselves, infiltrating host immune cells, or a combination of the two. A recently developed drug that blocks the activity of CCL17 and CCL22 blocked T reg migration into EBV+ and LMP1+ tumors, suggesting that this may be part of an effective treatment for EBV+ tumors in the clinic, helping to reduce the over 140,000 annual deaths from this group of cancers.

Citation: Jorapur A, Marshall LA, Jacobson S, Xu M, Marubayashi S, Zibinsky M, et al. (2022) EBV+ tumors exploit tumor cell-intrinsic and -extrinsic mechanisms to produce regulatory T cell-recruiting chemokines CCL17 and CCL22. PLoS Pathog 18(1): e1010200. https://doi.org/10.1371/journal.ppat.1010200 Editor: Christian Munz, University of Zurich, SWITZERLAND Received: May 25, 2021; Accepted: December 13, 2021; Published: January 13, 2022 Copyright: © 2022 Jorapur et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: All raw RNA-Seq data has been submitted to the NCBI SRA database (accession PRJNA736082). All other relevant data are within the manuscript and its Supporting Information files. Funding: RAPT Therapeutics supported the research conducted by all authors except VB and PB. Employees of RAPT Therapeutics were involved in the design, data collection and analysis, decision to publish, and preparation of the manuscript. All coauthors identified as RAPT Therapeutics employees received a salary from RAPT Therapeutics, including AJ, LAM, SJ, MX, SM, MZ, DXH, OR, JJJ, DW, DGB, OT, PDK, and GC. PB was the recipient of a grant from the Bristol-Myers-Squibb Foundation for Research in Immuno-Oncology n° 1709-04-040. Competing interests: I have read the journal’s policy and the authors of this manuscript have the following competing interests: The authors who are identified as current or former employees of RAPT Therapeutics have a potential financial interest in the development of RAPT Therapeutics’ FLX475, a drug related to the molecule discussed in this manuscript. No competing interests are reported for the other authors.

Introduction The Epstein-Barr Virus (EBV) is one of the most ubiquitous known human viruses, with most individuals infected during childhood or adolescence [1,2]. EBV was also the first virus recognized as oncogenic in humans with the discovery of its role in the etiology of nearly 100% of endemic Burkitt’s lymphoma (BL). Since that discovery, EBV has been identified as an important etiological factor in other B-cell lymphomas as well as T and natural killer lymphomas, and epithelial carcinomas including nearly 100% of nasopharyngeal (NPC) and approximately 10% of gastric carcinomas [3–5]. As of 2010, EBV+ tumors were estimated to account for over 140,000 annual deaths globally, with particular impacts in Asia and Africa[6]. In cells latently infected with EBV, the viral genome has the coding potential for 70–80 genes, presenting the potential for numerous foreign antigens to be recognized by the immune system [7,8]. The fact that EBV+ tumors are able to develop suggests that these tumors must have mechanisms for immune escape [8–12]. One such mechanism is the recruitment of regulatory T cells (T reg ) into the tumor microenvironment (TME). T reg are a subtype of CD4+ lymphocytes that suppress the activity of cytotoxic CD8+ T cells and dampen antitumor immune responses [13]. High T reg infiltrates in various EBV+ tumors have been noted [14–17]. T reg have been shown to be recruited to the TME via C-C motif chemokine ligand 17 (CCL17) and C-C motif chemokine ligand 22 (CCL22; herein described together as CCL17/22) that are expressed directly by some lymphomas or by infiltrating immune cells within the TME [10,18–21]. These chemokines are recognized by T reg -expressed C-C chemokine receptor type 4 (CCR4). In fact, a link between EBV infection and upregulation of CCL17/22 expression in lymphomas has been observed and mechanistically linked to the action of the viral latent membrane protein 1 (LMP1) [14,18,19,21]. LMP1 contributes to the transformation and survival of B cells by multiple pathways, including the activation of NFκB—putatively the mechanism for CCL17/22 expression in these cells [20,22]. While expression of these chemokines by immune cells is widely described, the mechanism for CCL17/22 expression in EBV+ tumors of epithelial origin, such as NPC, is less clear. Here, we provide further evidence for a link between LMP1 expression and CCL17/22 production in EBV+ tumors and demonstrate that this production supports the migration of T reg cells in vitro and in vivo. That this migration was largely blocked by a novel small-molecule antagonist of the CCR4 receptor, CCR4-351 [23], highlights the importance of the CCL17/22/CCR4 chemotactic axis in promoting T reg accumulation in these tumors. While RNA in situ hybridization (ISH) showed a strong link between EBV-positivity and chemokine expression in Hodgkin lymphoma, a mix of tumor cell-intrinsic and -extrinsic expression of these chemokines was revealed in NPC. Human NPC xenografts grown in immuno-deficient mice further demonstrated this mixed tumor-intrinsic and -extrinsic expression of CCR4 ligands. Finally, by evaluating a mouse colon tumor cell line, CT26, engineered to overexpress LMP1, we detected a marked increase in CCL17/22 production by both tumor and dendritic cells accompanied by an influx of T reg . Thus, we have observed varied but convergent mechanisms for CCL17/22 expression that could lead to a TME rich in T reg . Treatments that decrease T reg infiltration or activity, such as a CCR4 antagonist, may be effective immunotherapeutics against multiple EBV+ tumor types.

Discussion The treatment of tumors with immune-based therapies, known as immuno-oncology (IO), holds great promise. There are a multitude of approaches from protein therapeutics such as the approved anti-PD-1, anti-PD-L1, and anti-CTLA-4 checkpoint antibodies to cell-based therapies and small molecule therapies. These therapies are each expected to be active only against tumors with particular immunologic or antigenic phenotypes. We would expect that EBV-driven tumors, which should be particularly immunogenic due to the expression of foreign viral antigens, to employ particular immune-evasive strategies that could be targeted by matched IO approaches. Support for this conjecture comes from multiple observations of high levels of infiltrating T reg in different types of EBV+ tumors (this work and [14,16,17,29,40]). T reg are a type of CD4+ lymphocyte that tempers inflammation by suppressing the activity of cytolytic CD8+ T cells. A pan-tumor analysis shows that T reg levels track those of CD8+ cells, suggesting an adaptive immune resistance mechanism that acts as a negative feedback process in the TME. Thus, reducing the activity or number of T reg may help to drive antitumor immune responses in these tumor types. The chemokines CCL17 and CCL22 are potent activators of the chemokine receptor CCR4, and this CCL17/22/CCR4 axis may be the major mechanism for recruiting T reg into tumors (this work and [41–43]). Although TGFβ can support the conversion of CD4+ T cells to T reg as well as their subsequent proliferation, existing data suggests that migration rather than conversion/expansion is the key driver of T reg numbers in tumors [23,44]. Here, we show that out of a variety of human EBV+ tumor-derived cells lines, only those of B-lymphoma origin that express LMP1 also secreted both CCL17 and CCL22 at high levels in vitro. This is in agreement with other work such as in age-related EBV+ B-cell lymphoproliferative disorder (ALPD) [19]. Reducing LMP1 mRNA levels in these cells via siRNA reduced CCL17/22 expression. LMP2A, which has been shown to cooperate with LMP1 for its activity [24,25], also affected CCL17/22 production but did not appear to be sufficient in these cells. Since LMP1 is believed to mimic CD40 activation in B cells [27,28], a process which normally leads to CCL17/22 expression, there is a clear mechanism driving this pathway. Less clear has been the mechanism for CCL17/22 expression in EBV+ tumors of epithelial origin. The EBV+ gastric carcinoma cell line we tested, NCI-N87, did not produce either chemokine in vitro and RNA expression data for the NPC cell line C666-1 showed barely detectable chemokine levels [45]. However, we observed that the most common EBV+ epithelial tumor types, EBV+ gastric carcinoma and nasopharyngeal carcinoma, are among the highest expressors of both chemokines. Strikingly, these appear to also be the highest T reg -infiltrated tumors based on levels of FOXP3 expression across nearly 10,000 disparate samples. Matching these tumor expression data, we observed chemokine expression by RNA ISH in NPCs and in NPC xenografts. Unlike the expression pattern we observed in Hodgkin lymphomas, where CCL17/22 expression was strongly linked to EBV-positivity, the NPCs showed chemokine expression that appeared to be a combination of tumor cell-intrinsic and expression by tumor-infiltrating EBV- cells. A mixed human/mouse xenograft system allowed us to more cleanly observe the sources of chemokine expression. In fact, both human and mouse CCL22 expression was observed, and this expression was localized, respectively, to tumor cells and regions of host cell infiltration. LMP1 is not expressed in all NPCs [46,47] and is detected in only one of the NPC xenografts we tested (C15; [32]). Interestingly, LMP1-negative NPCs have been shown to have genetic alterations that can mimic the effects of LMP1 expression such as the genetic TRAF3 inactivation in C666-1 cells that mimics TRAF3 sequestration by LMP1 [48–50]. The better-established NFκB-activating role of LMP1 in EBV+ lymphomas led us to test the effect of engineered LMP1 expression on CCL17/22 expression in an exemplar epithelial tumor. We engineered the mouse colon cancer cell line CT26 to express LMP1 and assayed its chemokine production. Although no CCL17/22 expression was observed in vitro by either the parental CT26 cell line or by CT26-LMP1, strong chemokine expression was seen in vivo with CT26-LMP1 when the cell lines were grown as syngeneic tumors. Examining the tumors by single cell RNA-Seq revealed expression from the CT26-LMP1 tumor cells themselves as well as a major contribution from dendritic cells, especially from migratory DCs. These migratory DCs are a class of myeloid cells that bring antigen from peripheral tissues to lymph nodes [51], and their increased expression of the suppression-related chemokines CCL17 and CCL22 may play an important role in changing immune responses to EBV-infected tumors. DC migration is complex and only partially understood, with a variety of chemokines, including CCL19 and CCL21, and small molecules such as leukotriene B4 and oxysterols (which are bound by the intriguingly-named Epstein Barr Virus Induced Gene 2 receptor) acting as possible DC attractants [52,53]. Although we did not observe significant changes in the best known chemokine DC attractants, their general low levels of expression and restriction to specific cell compartments may have led to a lack of sensitivity in detection of such expression changes. Edwards et al. grew AGS, a human EBV- gastric cancer cell line, in vitro and in vivo in mice, along with an LMP1-expressing engineered version of AGS and an EBV-infected version of AGS as well as the human NPC xenografts C666, C15, and C17, and compared these cell lines and conditions by transcriptional and protein profiling[54]. While these experiments comparing the properties of EBV-related cell lines in vivo and in vitro are broadly similar to the experiments described herein, Edwards et al. did not identify the same biological processes we did. While one would hope that an upregulation of CCL17/22 would have been corroborated in that study, it is important to consider the major differences between these two studies: Edwards et al. looked at human cells in immune-deficient mice while we analyzed a mouse cell line in immune-competent mice; Edwards et al. used bulk, rather than single cell, RNA Sequencing that would likely miss changes due to rarer cells such as chemokine-expressing DCs; the differential gene expression analysis reported in Edwards et al. focused on the human gene expression changes as opposed to changes in the tumor-infiltrating mouse cells. Edwards et al. serves as an informative study of the changes to tumor-intrinsic pathways triggered by EBV, such as in vitro regulation of gene transcription by miRNAs[54]. Although the experiments reported here and mechanistic studies [19,20,50] show how EBV-derived LMP1 can lead to increased chemokine expression, the mechanism for the tumor-extrinsic increase in CCL17/22, shown here in a variety of settings, is less clear. We have shown that LMP1 expression leads to both an increase in the number of chemokine-expressing DCs and the level of chemokine expression in these cells. In contrast, no significant increase in mDC or cDC number was observed in the antigenicity-control model, CT26-OVA, and a more modest increase in chemokine expression was observed. Whether the difference between CT26-OVA and CT26-LMP1 is one of quantity, with perhaps LMP1 being more antigenic than OVA, or quality, where LMP1 participates in a specific biological pathway, is unknown. Regardless of which or both of these mechanisms are in play, we postulate that the net effect of EBV-LMP1 is a marked increase in CCL17/22 production that fosters an immune-suppressive environment beneficial to the EBV+ tumor. Further, regardless of mechanism, antagonism of CCR4 by CCR4-351, a novel, oral specific small-molecule inhibitor, completely blocked the new infiltration of T reg -polarized cells in our mouse model. In summary, multiple lines of evidence suggest that suppression of productive inflammation by T reg may be a common mechanism employed by EBV+ tumors of both lymphocytic and epithelial origins. In both cases, tumor-produced chemokines CCL17 and CCL22 trigger T reg migration by activating the CCR4 chemokine receptor, and, in both cases, the viral protein LMP1 may be central to this process. In lymphomas, LMP1 has been shown to coopt existing B cell-intrinsic pathways to directly upregulate the chemokines. In contrast, chemokine production in epithelially-derived EBV+ tumors is likely due to a combination of both tumor-intrinsic and tumor-extrinsic mechanisms. LMP1 and/or other viral proteins may lead to the indirect production of CCL17/22 in EBV+ tumors via recruitment of infiltrating cells such as dendritic cells followed by tumor-intrinsic CCL17/22 expression in response to the activity of these infiltrating immune cells. These data suggest that blocking the T reg CCR4 receptor, such as with the selective antagonist CCR4-351, may be an effective way to potentiate antitumor inflammation and be an important part of a pan-EBV+ tumor therapy.

Material and methods Ethics statement Propagation in nude mice was done with the approval of the Gustave Roussy Ethics Committee for Animal Experimentation (APAFIS#1605-2015090216498538v2 –November 26, 2015). Animal studies Six- to eight-week old female mice were obtained from JAX Mice and Services (Bar Harbor, ME): Balb/cJ (000651), C57BL/6-Tg(Foxp3-GFP)90Pkraj/J (023800), Foxp3-GFP-Balb/cJ (006769) and NOD.CB17-Prkdcscid/J (001303). Animals were randomized between groups and none were excluded after randomization. Experiments were conducted in compliance with internal protocols reviewed and approved by the IACUC at RAPT Therapeutics. CCR4 antagonist CCR4-351 was designed, synthesized and characterized at RAPT Therapeutics (Compound 38 in Robles et al. [55]). Cells and culture conditions Raji, Daudi, NC-37, NCI-N87, Jijoye, Ramos, CT26, CT26-OVA, and CT26-LMP1 cells were grown in complete RPMI-1640 (Basal medium with 1% NEAE, 1% Penicillin-Streptomycin, 100IU/mL L-glutamine), 10% FBS and plated at 0.5x106/mL in a T-25 flask. P3HR1 and KATO III were grown as above, but with 20% FBS. Namalwa were cultured in RPMI-1640 with 2 mM L-glutamine adjusted to 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate, 92.5%; fetal bovine serum, 7.5%. Media was changed every 24hr for treatments longer than 72hr. CCRF-CEM cells were seeded at 0.2–0.3 million cells/mL and cultured in complete RPMI-1640, 10% FBS. Cells were obtained from the American Type Culture Collection (ATCC), frozen at passage 3–5, and used at passage 4–6. CT26-OVA and CT26-LMP1 were generated by stable transduction with adenovirus carrying chicken ovalbumin (OVA) or EBV LMP1 under control of the CMV promoter. Supernatants were collected 24hr after the final split. Western blotting Whole-cell lysates in RIPA (with phosphatase and protease inhibitors) were boiled for 10 minutes in LDS buffer with reducing agent, separated by 4–12% SDS-polyacrylamide gel electrophoresis, and transferred to nitrocellulose membrane. Membranes were blocked with 5% milk in Tris-buffered saline-Tween 20 and incubated overnight at 4°C with primary antibodies: anti-LMP1 (A301-957A, ThermoFisher, TFS), anti-LMP2A (MA1-81921, TFS), anti-EBNA1 (sc-81581, Santa Cruz Biotechnology), anti-HSP90 (4874S, New England Biolabs, NEB), or anti-Actin (4970S, NEB). Membranes were washed and incubated with HRP-conjugated secondary antibodies for 1hr at room temperature (RT), followed by rewashing and visualization with enhanced chemiluminescence reagent. Densitometry was done with Li-Cor Image Studio Lite software. ELISA Chemokines were assayed using ELISA kits according to manufacturer protocols for CCL17 (human DDN00, mouse DY529-05), CCL20 (human DM3A00), CCL22 (human DMD00, mouse MCC220); all from R&D Systems. siRNA Transfection Raji cells were seeded at 106 cells/well in 6-well plates to reach 80% confluence the following day. To transfect, 10 μL lipofectamine 2000 (Invitrogen) in 250 μL Opti-MEM and 40 μM of siRNA in 250 μL Opti-MEM were incubated separately for 4 minutes at RT, combined, mixed gently, incubated for 20 minutes at RT, and added to cells in 2 mL RPMI 1640 for 4hrs before washing. siRNA sequences were: LMP1 GGAAUUUGCACGGACAGGCUUUU; LMP2A AACUCCCAAUAUCCAUCUGCUUU; LMP1 control AACUCCCAAUAUCCAUCUGCUUU; LMP2A control CUCCCAAUUAGCAUCUGCUTTUU (nucleotides 9 and 11 switched in negative control siRNAs [56]). Human T reg in vitro generation Human T reg -polarized CD4+ cells (induced T reg ; iT reg ) were generated as previously described [42]. Routinely, >90% of CD4+ cells expressed Ccr4 and 30–60% expressed FoxP3. iT reg suppressed CD8+ T cell activation at levels comparable to natural T reg isolated from human PBMCs. Mouse GFP T reg in vitro generation Single-cell suspensions were prepared from spleen and lymph nodes from 6-8-week-old C57BL/6-Tg (Foxp3-GFP) 90Pkraj/J mice (in vitro studies) or 6–8-week-old Foxp3-GFP-Balb/cJ (in vivo studies). Red blood cells were removed using 1x ACK lysis buffer (Gibco, A1049201). CD4 cells were isolated by depleting CD25+ cells using the CD25 MicroBead Kit (130-091-072, Miltenyi Biotec) and enriched using a CD4 T Cell Isolation Kit (130-104-454, Miltenyi Biotech). Cells were cultured in anti-mouse-CD3-coated plates in complete DMEM (MT10013CV, TFS) with 1% NEAE, 1% Penicillin-Streptomycin, 100IU/mL, L-glutamine, 10% FBS. Complete media was supplemented with β-Mercaptoethanol (21985023, TFS), 5 ng/mL of TGF-β (7666-MB-005, R&D Systems), IL-2 (402-ML-020, R&D Systems), anti-IFN-γ (BE0055, Invivogen), anti-IL-4 (BE0045, Invivogen), and 1 μg/mL anti-CD28 (16-0281-86, TFS); and cultured in 5 μg/mL anti-CD3 (16-0031-85, TFS) coated plates at a concentration of 106 cells/mL. On day 3, cells were cultured in RPMI medium with 20 ng/mL IL-2. Cells were harvested on day 7 for studies. Over 90% of T reg -polarized cells expressed CD25 and GFP. Raji/Daudi tumor models NOD-SCID (6–8 months) mice were injected subcutaneously with 2x106 cells in 100 μL PBS with 100 μL Matrigel (CB40234A, TFS). Tumors were harvested at 200–400 mm3 and lysed in 25 mM HEPES, 150 mM NaCl, 1% Triton X-100, 5 mM EDTA at pH 7.4 with metallic beads with pulsed shaking. Lysates were quantified via Bradford assay and normalized to tumor weight. Human T reg migration study–Raji/Daudi When Raji tumors reached volumes of 200–400 mm3, mice were treated with 50 mg/kg CCR4-351 and 3 hours later injected with 8x106 human iT reg (>90% purity by Flow analysis of CD4, CD25 and CCR4). Tumors were harvested after 7 days into digestion buffer with DNase (89836, TFS) and lysed in gentleMACS C tubes (130-093-237, Miltenyi Biotec) using the Gentle MACS Octodissociator. Staining was performed with: TruStain FcX (anti-mCD16/32) antibody (101320, Biolegend), human TruStain FcX (422302, Biolegend), hCD4 APC Cy7 (317450, Biolegend), hCD45 PE Cy7 (368532, Biolegend), mCD45 BV510 (103138, Biolegend), hCD19 APC (392504, Biolegend), hCCR4 APC (59407, Biolegend), 7-AAD live/dead stain PERCP Cy5.5 (420404, Biolegend). Data was collected on BD Fortessa and analyzed using FlowJo software. In vitro chemotaxis Assays were performed using the ChemoTX migration system with a 5 μm pore size PCTE membrane (106–5, Neuro Probe). CCRF-CEM cells were resuspended at 2x106 cells/mL in human serum. CCR4-351 (300 nM) or DMSO were added to a DMSO concentration of 0.25% (v/v) followed by a 30-minute preincubation. 29 μL of recombinant hCCL22 (diluted to 0.9 nM in 1xHBSS with 0.1% BSA) or supernatant from cultured cells was dispensed in the lower wells. PCTE membrane was placed onto the plates and 50 μL of the CCRF-CEM cell/compound mixture was transferred on top. Plates were incubated at 37°C, 100% humidity, 5% CO 2 for 60 minutes, then the membranes were removed and 15 μL Cell Titer Glo was added to lower wells. Luminescence was measured using an Envision plate reader (PerkinElmer). Mouse in vivo T reg migration After CT26, CT26-LMP1, and CT26-OVA tumors reached 200–300 mm3, mice were given 50 mg/kg CCR4-351 or vehicle orally. Three hours later, mice were injected intravenously with GFP+ iT reg at 97% purity and 27% CCR4-positivity. Tumors were harvested after 7 days, during which CCR4-351 was dosed orally daily, and incubated in digestion buffer with DNAse and lysed in Miltenyi C tubes using the Gentle MACS Octodissociator. A single cell suspension was prepared from spleens using syringes, filtered and stained for: TruStain FcX anti-mouse CD16/32 antibody (101320), CD4 APC Cy7 (100414), mouse CD45 BV510 (103138), mouse CD8 PE Cy7 (100722), GFP-FoxP3-FTIC, 7-AAD Live dead stain PERCP Cy5.5 (420404), mouse CCR4 APC (359410), CD11c BV605 (117334), MHC II (I-A/I-E Antibody) APC (107614), CD11b PE (101208), F4/80 (123141), and M1/70 BV785 (101243); all from BioLegend. Data was collected on BD Fortessa and analyzed using FlowJo. Bulk RNA-Seq Solid tumor TCGA and TARGET RNA-Seq datasets were downloaded from the UCSC Xena data hub [57] on June 18th, 2017. NPC datasets GSE102349 [58] and GSE68799 were downloaded from NCBI GEO and processed with Kallisto [59]. Counts across all data sets were quantile-normalized using preprocessCore [60]. EBV status for GC was obtained from cBioPortal [61]. S1 Table shows tumor-type abbreviations. Single cell RNA-Seq After tumors reached 200–300 mm3, they were collected and digested with collagenase buffer in a 37°C bath, pipetting every 10 minutes to dissociate. Cells from 5 tumors were pooled per sample. Cell surface protein feature barcoding (CITE seq) antibody (BioLegend TotalSeq-A) incubation was performed per manufacturer protocols, and cells were processed for 10X Chromium 3’ RNA seq (v3) chemistry reagents with slight modifications for CITE seq. FASTQ files were aligned to the mouse mm10 genome with CellRanger (v3.1.0). Data was analyzed in R [62] using Seurat (v3.2.2) [63] and tidyseurat [64] packages. scRNA data deposited as PRJNA736082 to SRA. RNA in situ hybridization HL biopsies were purchased from US Biomax (HL801a, Rockville, MD) as a tumor microarray. NPC tumor slices were purchased from ACD Bio (AB, Newark, CA). FFPE-preserved paraffin-embedded samples were probed on the RNAscope platform [31]. Two EBER1 double-Z probe pairs (310271-C2, AB), 20 CCL22 probe pairs (468701, AB), 13 CCL17 probe pairs (468531, AB), and 20 FOXP3 probe pairs (418471-C2, AB) were used. Following hybridization and chromogenic detection, hematoxylin counterstaining was followed by blueing. Imaging was done on the Leica AT2 scanner and analyzed with Indica Labs (Albuquerque, NM) HALO software. NPC Xenografts C15, C17, and C18 are patient-derived xenografts (PDX) from cells propagated solely in nude mice [65,66]. The C666-1 NPC tumor line was first established as a PDX and later as a cell line propagated in vitro[67] and recently re-implanted in nude mice by one of us (PB). Statistics Significance tests used for data in plots are two sample Student’s t-tests unless otherwise noted. Significance for LMP proteins and chemokines reported for Fig 1A was calculated by the R “stats::cor.test” function using Pearson correlations and two-sided hypothesis testing. A repeated measures ANOVA was used for data in Fig 2D. Significance codes for p-values are: **** = p < 0.0001, *** = p < 0.001, ** = p < 0.01, * = p < 0.05.

Acknowledgments This research was supported by RAPT Therapeutics, formally known as FLX Bio. Urvi Kolhatkar helped with densitometry. We thank Abood Okal for providing insight and expertise that greatly assisted the research. We are grateful to Steve Wong, Martin Brovarney, Justy Guagua, Jerick Sanchez, David Chan and Angela Wadsworth for providing their technical expertise during the course of this research. We are very grateful to Heather Milestone for chemokine-induction experiments that did not appear in the manuscript. Finally, we thank Brian Wong, CEO of RAPT Therapeutics, for manuscript review and continual support for this work.

[END]

[1] Url: https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1010200

(C) Plos One. "Accelerating the publication of peer-reviewed science."
Licensed under Creative Commons Attribution (CC BY 4.0)
URL: https://creativecommons.org/licenses/by/4.0/


via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/