(C) PLOS One
This story was originally published by PLOS One and is unaltered.
 . . . . . . . . . .



Engineering of a high-fidelity Cas12a nuclease variant capable of allele-specific editing [1]

['Jingjing Wei', 'Department Of Cardiology', 'The First Affiliated Hospital Of Zhengzhou University', 'Zhengzhou', 'Center For Medical Research', 'Innovation', 'Shanghai Pudong Hospital', 'Fudan University Pudong Medical Center', 'School Of Life Sciences', 'Shanghai Engineering Research Center Of Industrial Microorganisms']

Date: 2024-06 

Plasmid construction

Plasmids for Cas12a orthologs or crRNA expression. The plasmid pAAV-CMV-notracr vector was amplified by primers pAAV-notracr-F/pAAV-notracr-R using pAAV-CMV-SauriCas9-puro (Addgene No. 135965) as a template. The human codon-optimized Cas12a gene was synthesized by HuaGene (Shanghai, China) and cloned into the pAAV-CMV-notracr backbone by the NEBuilder assembly tool (NEB). The sequence of each Cas12a protein was confirmed by Sanger sequencing (GENEWIZ, Suzhou, China). Oligonucleotide duplexes corresponding to Cas12a orthologs and spacer sequences were PCR amplified and ligated into pSK-mU6-Cj-sgRNA-SV40-puro plasmids (Addgene No. #192128) for mU6 promoter-driven expression of crRNAs. The sequences of the Cas12a gene and crRNA used in this study are listed in S1 Table.

Cell culture and transfection. All cells were grown in humidified 37°C, 5% CO 2 incubators. HEK293T, HeLa, A375, SH-SY5Y, and N2a cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM). HCT116 cells were maintained in McCoy’s 5A. All the cells were supplemented with 10% FBS (Gibco), 100 U/mL penicillin, and 100 mg/mL streptomycin. All cell lines used were tested negative for Mycoplasma contamination. A day before transfection, cells were trypsinized and seeded to each well of the 48-well plate. For transient transfection, cells were transfected with Cas12a plasmids (300 ng) + sgRNA plasmids (200 ng) by Lipofectamine 2000 or 3000 (1 μL) (Life Technologies) according to the manufacturer’s instructions. HEK293T, HeLa, and N2a cells were transfected with Lipofectamine 2000 (Life Technologies). SH-SY5Y, A375, and HCT116 cells were transfected with Lipofectamine 3000 (Life Technologies). Cells were collected 5 days after transfection. Genomic DNA was isolated, and the target sites were PCR-amplified by nested PCR amplification and purified by a Gel Extraction Kit (QIAGEN) for deep sequencing. The primer sequences for deep sequencing are listed in S2 Table. The guide RNA sequences used in this article are listed in S3 Table.

Phylogenetic analysis. Phylogenetic analysis was conducted using the vector NTI software, employing its default parameters. The Clustal W algorithm served as the alignment method. In essence, an initial assessment of crude similarity among all sequence pairs, termed “Parities alignment,” is conducted. These similarity scores are subsequently employed in generating a “guide tree” or dendrogram. This dendrogram dictates the order in which sequences are aligned during the final multiple-alignment stage. Following the calculation of the dendrogram, sequences are aligned progressively, starting with smaller groups and expanding until the entirety of sequences is encompassed in the conclusive alignment. This method ensures a systematic and comprehensive approach to multiple sequence alignment.

Construction of GFP activation system for PAM detection. The reporter plasmid was constructed as previously described with minimal modifications [36]. Briefly, The DNA oligonucleotide (NNNNNGGATATGTTGAAGAACACCATGAC) with 20-nt flanking homologous sequences (AAGCCTTGTTTGCCACCATG/GTGAGCAAGGGCGAGGAGCT) for Gibson Assembly were synthesized by GENEWIZ (Suzhou, China). Subsequently, full-length oligonucleotides were PCR-amplified utilizing Q5 High-Fidelity 2X Master Mix (NEB), followed by size selection on a 3% agarose gel EX (Life Technologies, Qiagen) and purification using the MinElute Gel Extraction Kit (Qiagen). The PCR products were then cloned into a lentiviral vector through Gibson Assembly (NEB) and further purified with Agencourt AMPure XP SPRI beads (Beckman Coulter). Electroporation of the Gibson Assembly products into MegaX DH10BTM T1R ElectrocompTM Cells (Invitrogen) was carried out using a GenePulser (BioRad). Subsequently, the bacteria were introduced into recovery media and allowed to grow at 32°C with agitation at 250 rpm overnight. Plasmid DNA was then purified from the bacteria using the Endotoxin-Free Plasmid Maxiprep kit (Qiagen).

PAM sequence analysis. The reporter plasmids were packaged into lentivirus and transfected into HEK293T cells as previously described [36]. Five days after transfection of Cas12a (10 μg) and gRNA-expressing plasmids (5 μg) into cells, genomic DNA was isolated for targeted deep sequencing of the random region. For PAM analysis, the 20-nt oligonucleotide flanking the target sequence was used to fix the target sequence. The sequences TTGTTTGCCACCATG and GGA were employed to fix the 5-nt random sequence. Target sequences with in-frame mutations were utilized for PAM analysis. The 5-nt random sequence was extracted and visualized using WebLogo3 [37] and a PAM wheel chart [38] to illustrate PAMs.

Western blot analysis. HEK293T cells were seeded into 24-well plates and transfected with Cas12a-expressing plasmid (800 ng) using Lipofectamine 2000 (Invitrogen). Three days after transfection, cells were collected and resuspended in lysis buffer for western blotting (Beyotime) supplemented with 1 mM phenylmethanesulfonyl fluoride (PMSF) (Beyotime). Cell lysates were then centrifuged at 12,000 rpm for 20 minutes at 4°C, and the supernatants were collected for western blotting. An equal amount of protein samples was separated by SDS-PAGE gel and transferred to PVDF membranes. After blocking, membranes were probed with the anti-HA antibody (1:1,000; Abcam) and anti-GAPDH antibody (1:1,000; Cell Signaling) at 4°C overnight. The membranes were washed 3 times in TBS-T for 5 minutes each time and incubated in the secondary goat anti-rabbit antibody (1:10,000; Abcam) for 1 hour at room temperature. The membranes were then washed with TBST buffer 3 times and imaged.

Immunofluorescence staining. For the efficient nuclear localization of these Cas12a variants, HEK293T cells were seeded into 24-well plates and transfected with Cas12a-expressing plasmid (800 ng) using Lipofectamine 2000 (Invitrogen). Three days after transfection, some cells were seeded into a 35-mm confocal dish. Next day, cells were fixed for 30 minutes in 4% paraformaldehyde (PFA) in PBS and permeabilized with 0.3% triton X-100 for 20 minutes at room temperature, followed by blocking with 5% BSA in PBS for 1 hour and then incubated with anti-HA antibody (Abcam, ab18181) overnight at 4°C. After 3 washes, cells were incubated with goat anti-mouse FITC 1:300 (Abcam, ab6785) for 1 hour at room temperature. After 3 washes, the cells were imaged with a Zeiss LSM 880 confocal microscope.

Protein expression and purification. The E. coli expression plasmid of Mb4Cas12a containing a 6xHis-tag at N-terminal followed by a cleavage site for PreScission protease (PSP) were transformed in E. coli Rosseta (DE3) cells. Transformed bacteria were cultured into Terrific Broth (TB) medium at 37°C before being induced with 0.1 mM isopropyl-1-thio-β-d-galactopyranoside at an OD600 of 0.6 and grown at 16°C for 16 to 18 hours. Bacteria were lysed in 50 mM HEPES (pH 7.5), 300 mM NaCl, 30 mM imidazole, 1 μM DNase I, 1 mM PMSF, and 2 mM β-mercaptoethanol (β-ME) using a cell disruptor (JNBIO) and subjected to centrifugation at 20,000 × rpm for 90 minutes. The supernatant was filtered and applied to the first Ni-NTA column (GE Healthcare) equilibrated with binding buffer (20 mM HEPES (pH 7.5), 300 mM NaCl, 30 mM imidazole, and 2 mM β-ME). After being washed with wash buffer (20 mM HEPES (pH 7.5), 300 mM NaCl, 30 mM imidazole, and 2 mM β-ME), proteins were eluted with elution buffer (20 mM HEPES (pH 7.5), 300 mM NaCl, 300 mM imidazole, and 2 mM β-ME). The eluted protein was incubated with glutathione S-transferase (GST)-fused PSP to remove the 6xHis-tag and dialyzed overnight against dialysis buffer (20 mM HEPES (pH 7.5), 300 mM NaCl, and 2 mM β-ME). After dialysis, PSP was removed using a GST column. The protein was reapplied to the second Ni-NTA column equilibrated with dialysis buffer. Wash buffer was used to elute the proteins, which were subsequently loaded onto a Superdex 200 pg column (GE Healthcare) equilibrated with gel filtration buffer (20 mM HEPES (pH 7.5), 300 mM NaCl, and 1 mM dithiothreitol (DTT)). The proteins were eluted in a discrete peak corresponding to a molecular mass of approximately 170 kDa and stored at −20°C. Then, the protein can be either used directly for biochemical assays or frozen at −80°C. The sequence of bacterial expression plasmid is listed in S2 Table.

In vitro transcription of crRNAs. All crRNAs used in vitro cleavage experiments were synthesized using HiSribe T7 Quick High Yield RNA Synthesis Kit (NEB) according to the manufacturer’s instructions. ssDNA oligos corresponding to the reverse complement of the target RNA sequence and a short T7 priming sequence were synthesized and annealed to obtain the template of the transcription reaction. T7 transcription was performed for 16 hours, and then RNA was purified using by RNA Clean XP (Beckman) beads and stored at −80°C. The ssDNA oligos used for crRNA transcription are listed in S2 Table.

In vitro cleavage assay. For in vitro transcription, dsDNA substrates consisting of TTN nucleotides upstream of the protospacer were generated by PCR amplification. Cleavage in vitro was performed with purified proteins and corresponding crRNAs at 37°C in cleavage buffer. Approximately 200 ng DNA substrate was incubated with 250 nM Mb4Cas12a protein, 500 ng crRNA, and 0.3 μL RNase inhibitor in 1x NEB Buffer 3.1 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl 2 , and 100 μg/mL BSA). The cleavage products were denatured by incubating with 5 μg RNase A to digest crRNAs at 37°C for 20 minutes and 1 μL proteinase K to degrade Cas12a protein at room temperature for 10 minutes. The cleavage products were analyzed by 2% agarose gel electrophoresis. For the functional time of Mb4Cas12a, the cleavage reactions were performed at 37°C for 8 hours in a cleavage buffer. To determine the thermostability of Mb4Cas12a, the cleavage was reacted at a large-range temperature (4°C to 100°C) for 1 hour in the cleavage buffer. Where applicable, quantitation of DNA cleavage or nicking was determined by the formula cleavage (%) = 100 × (1-sqrt (1 − (b + c) / (a + b + c))), where a is the integrated intensity of the undigested products, and b and c are the integrated intensities of each cleavage or nicking products.

Generation of the Mb4Cas12a variants. The human codon-optimized Mb4Cas12a variants were cloned by circular PCR reaction. Briefly, wild-type Mb4Cas12a was used as the template to amplify PCR fragments using primers containing the mutation site. The primers are listed in S2 Table.

Test of Cas12a specificity. To test the specificity of LbCas12a, Mb4Cas12a, and its variants, we generated a GFP-reporter cell line with 5′-NTTTN (GTTTT) PAM. HEK293T cells were seeded into 48-well plates and transfected with Cas12a plasmids (300 ng) and crRNA plasmids (200 ng) by using Lipofectamine 2000 (1 μL). Five days after transfection, the GFP-positive cells were analyzed using the Calibur instrument (BD). Data were analyzed using the FlowJo software.

GUIDE-seq. GUIDE-seq experiments were performed as previously described [39]. Briefly, on the day of the experiment, 100 pmol of the double-stranded oligonucleotide (dsODN) GUIDE-seq tag was transfected into HEK293T cells with 500 ng Cas12a plasmid, 500 ng crRNA plasmid through the Neon Transfection System. The electroporation voltage, width, and number of pulses were 1,150 V, 20 ms, and 2 pulses, respectively. Genomic DNA was extracted with the DNeasy Blood and Tissue kit (QIAGEN) 5 to 7 days after electroporation. Approximately 500 ng of genomic DNA from each sample were randomly fragmented by NEBNext Ultra II FS DNA Module (NEB). A cleanup with 35 μL of AMPure XP beads (1X ratio) is performed according to manufacturer protocol and eluted in 12 μL of ddH2O. Around 10 μL end-repaired DNA was incubated with 10 μL NEBNext Adapter (E7335L), and 5 μL Quick T4 DNA Ligase in 2x Quick Ligation Reaction Buffer at 20°C for 15 minutes. The sequence of the NEBNext Adapter is listed as follows: 5′-/5Phos/GAT CGG AAG AGC ACA CGT CTG AAC TCC AGT CdUA CAC TCT TTC CCT ACA CGA CGC TCT TCC GAT C-s-T-3′. Then, 3 μl of USER Enzyme was added to the ligation mixture at 20°C for 15 minutes. Two rounds of nested anchored PCR, with primers complementary to the oligo tag, were used for target enrichment. Amplicons were purified by AMPure XP beads and sequenced on an Illumina sequencer. Restriction fragment-length polymorphism (RFLP) assays were used to assess oligo tag integration rates. Guide-seq v1.0.2 was used for GUIDE-seq analysis. The primer sequences for Guide-seq are listed in S2 Table.

Mb4Cas12a-F370A-targetable sites in ClinVar and dbSNP databases. Mutation sites in the human reference genome (GRCh38) were downloaded from the NCBI ClinVar and dbSNP databases. Mb4Cas12a-F370A-targetable sites and available gRNAs were analyzed according to the previously reported pipeline. Briefly, the flanking sequences (30 nucleotides from both upstream and downstream regions) of the mutation sites, including all mutations in dbSNP and “single-nucleotide variants (SNVs)” of “pathogenic” significance in ClinVar, were extracted from the human reference genome (GRCh38) for the subsequent analysis. Next, flanking regions were searched to find 5′PAM sequences (YYN) that could fit the SNV into the preferred editing window of Mb4Cas12a-F370A (positions 1 to 2, 4 to 5, 7, 10, 13 to 18 in the PAM proximal regions). At the same time, the corresponding gRNA spacer sequences could also be determined and output. The same procedure was used for the reverse complement strand. The resulting datasets were presented as S4 Table (targetable ClinVar and dbSNP variants with Mb4Cas12a-F370A).

[END]
---
[1] Url: https://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.3002680

Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.

via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/