[--------------------------------------------------------------------------] ooooo ooooo .oooooo. oooooooooooo HOE E'ZINE RELEASE #580 `888' `888' d8P' `Y8b `888' `8 888 888 888 888 888 "DNA, The Perfect Template 888ooooo888 888 888 888oooo8 for a Metaphor" 888 888 888 888 888 " 888 888 `88b d88' 888 o by Anilos [4/14/99] o888o o888o `Y8bood8P' o888ooooood8 [--------------------------------------------------------------------------] Over my spring break I learned a lot of different things, but more important of all is the epiphany I had one night in the vector of inspiration for me, the garage. I'm fairly certain now that Molecular Biology can be a metaphor for just about anything in life, allow me to elucdicate... DNA, the little molecule that is the blueprints for our entire body is essentially a message, a story, if you will. Before I continue I just would like to apologize to the people reading this and not understanding a damn thing, I just feel I should write about this since I find it fascinating. There is a lot about DNA that would take up pages and pages of explanation, but I'm trying to appeal to all people here so I'll try to make it short and simple. DNA is two nucleotides wound together in the double helix I'm sure everyone has heard at least once (i.e. Those who have seen Jurassic park, more than likely). The "rungs" on the DNA "Ladder" are essentially nitrogen bases We won't refer to them by their technical names and instead as A,T,G, and C. Now then, In DNA the A's must pair with a T and the G's must pair with a C and vice versa (T to A and C to G). If your still with me, pat yourself on the back, I don't plan on putting in any references to sex, gatorade or rage (which is going to be really hard for me). So, if your looking for any of the aforementioned, just stop. I'm sitting in my garage now and I was thinking about the days lesson in Molecular biology... Mutations. I began to think, "Hmm, now, mutations can be beneficial or harmful. And DNA itself is a message which might very well decide important aspects of our lives, therefore we can use DNA as a metaphor for life! Yes! This will probably bore some people, but goddamnit, I don't care." Let's write out a basic DNA 'Message': (I'm going to use an acquaintence's name as an example, and because it's already written down on paper and I don't want to use mine, it would take too long.) ACATTGTTTTTTGATCGGTTCTGGTTATTCTAGTAGGATCGCCCGTTTTTGCCACCA - Now, believe it or not, this in fact actually spells out my acquaintence's name "Matt Eric Biggerstaff" (The translation of the message isn't important nor relevant to the point of this, but hell, if your interested anyways just e-mail me). Basically, this is a normal, happy little piece of DNA. Mutations, though can screw the message up, so we can assume, that if life was a DNA strand, mutations could screw up someone's life. Let us look at some common mutations and practical applications to this metaphorical look at DNA: - Substitution: This is where one of the four letters (A,T,C, and G) are mispaired (ie. A to G or T to C). An example for life: Instead of your real dad, your mom re-marries and substitutes a step-dad, potentiality for a screw up/misreading of the DNA. - Insertion: DNA is read in tripletts (GAT, TTT, etc.) but with insertion you end up with sequences such as, GATA, TTT, etc. Another example for life: I began to date a very odd girl that only made my life miserable, essentially she was "inserted" into my life (I know some of you are giggling at the word 'insert'). - Deletion: When being read in tripletts, this is when a A,C,G or T is missing (i.e. the small message above, GAT, TTT may become GA, TTT). My example for life using someone I'm sure everyone has heard me bitch about: I dated this really nice girl, the most wonderful and best thing I've ever had in my fairly lonely and boring life. But I broke up with her because of reasons I even don't know, she was "deleted" from my life and of course everything went screwy. Many of you are probably thinking now, "But, mistakes can't screw up someone's entire life, your wrong in your comparison of DNA mutations to everyday life". True, you are very sharp indeed if you thought that. But alas, I'm not finished quite yet. Sure, one mistake obviously isn't going to screw over your entire life like a mutation can do in a human's DNA. But, there is a repair 'tool' you might say that exists in DNA. This veritable repair utility finds mutations and fixes them before they can cause any significant damage. I'm right, and your wrong. Whee, I love being in control somewhat. I hope this made at least a small amount of sense, if it didn't just tell me. I'll more than likely ignore you, but hey at least you tried! Or you can always deflate my ego by sending me a message pointing out mistakes. Either way, I'll write something more appealing to the masses next time, but for now I'm on spring break -- thank God -- and I feel like indulging in what I want. [--------------------------------------------------------------------------] [ (c) !LA HOE REVOLUCION PRESS! HOE #580 - WRITTEN BY: ANILOS - 4/14/99 ] .